Repbase Reports |
|---|
| 2022, Volume 22, Issue 9 |
| September 30, 2022 |
| Copyright © 2001-2024 - Genetic Information Research Institute, California |
| ISSN# 1534-830X |
| Page 5310 |
AcademH-N3_CorFlu |
|||
|---|---|---|---|
Transposable elements from the Asian clam genome: consensus. |
|||
|
Submitted: 30-Aug-2022 |
Accepted: 30-Sep-2022 |
||
|
Key Words: Academ; DNA transposon; Transposable Element; Nonautonomous; AcademH-N3_CorFlu |
|||
|
Source: Corbicula fluminea |
Organism: Corbicula fluminea |
Taxonomy: Eukaryota; Metazoa; Lophotrochozoa; Mollusca; Bivalvia; Heteroconchia; Euheterodonta; Veneroida; Corbiculoidea; Corbiculidae; Corbicula |
|
| [] |
Authors: Bao,W. |
||
|
Title: DNA transposons from the Asian clam genome. |
|||
|
Journal: Repbase Reports 22(9), 5310-5310 (2022) |
|||
Abstract: ~95% identical to the consensus. >60% of the loci shows 9-bp TSDs. 5'-end is similar to that of AcademH-2_CorFlu TAGTCTGGTTCCCGACTTCCTATAATAGT |||||||||||||||-|:|| |:|||||| TAGTCTGGTTCCCGA-TCCCAACAATAGT (AcademH-2_CorFlu). 3'-end is similar to that of AcademH-2_CorFlu TAGTCTGGATTACCTGCCCC-TT ||||||||-|| ||||||||-|| TAGTCTGG-TTCCCTGCCCCATT (AcademH-2_CorFlu).
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||