Repbase Reports |
|---|
| 2023, Volume 23, Issue 1 |
| January 31, 2023 |
| Copyright © 2001-2024 - Genetic Information Research Institute, California |
| ISSN# 1534-830X |
| Page 575 |
Mutsu-1_PaRa |
|||
|---|---|---|---|
Non-LTR retrotransposon from the Indian glass fish genome - consensus. |
|||
|
Submitted: 22-Aug-2022 |
Accepted: 31-Jan-2023 |
||
|
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Mutsu-1_PaRa |
|||
|
Source: Parambassis ranga |
Organism: Parambassis ranga |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Ovalentaria; Ambassidae; Parambassis |
|
| [] |
Authors: Kojima,K.K. |
||
|
Title: Non-LTR retrotransposons from the Indian glass fish genome. |
|||
|
Journal: Repbase Reports 23(1), 575-575 (2023) |
|||
Abstract: ~99.7% identical to consensus. It is inserted in 5S rRNA genes between GCTTACGGCCATACCACCCTGAACACGCCCG and CACGCCCGATCTCGTCCGAT with TSDs of CACGCCCG.
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||