Repbase Reports |
---|
2023, Volume 23, Issue 1 |
January 31, 2023 |
Copyright © 2001-2024 - Genetic Information Research Institute, California |
ISSN# 1534-830X |
Page 568 |
Mutsu-2_PaRa |
|||
---|---|---|---|
Non-LTR retrotransposon from the Indian glass fish genome - consensus. |
|||
Submitted: 22-Aug-2022 |
Accepted: 31-Jan-2023 |
||
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Mutsu-2_PaRa |
|||
Source: Parambassis ranga |
Organism: Parambassis ranga |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Ovalentaria; Ambassidae; Parambassis |
|
[] |
Authors: Kojima,K.K. |
||
Title: Non-LTR retrotransposons from the Indian glass fish genome. |
|||
Journal: Repbase Reports 23(1), 568-568 (2023) |
|||
Abstract: ~99% identical to consensus. It is inserted in 5S rRNA genes between GCTTACGGCCATACCACCCTGAACACGCCCG and CACGCCCGATCTCGTCCGAT with TSDs of CACGCCCG.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |