Repbase Reports |
|---|
| 2023, Volume 23, Issue 5 |
| May 31, 2023 |
| Copyright © 2001-2024 - Genetic Information Research Institute, California |
| ISSN# 1534-830X |
| Page 3260 |
Gypsy-58_NeMe-I |
|||
|---|---|---|---|
LTR retrotransposon from the round goby genome: internal portion - consensus. |
|||
|
Submitted: 29-Jan-2021 |
Accepted: 31-May-2023 |
||
|
Key Words: Gypsy; LTR Retrotransposon; Transposable Element; Gypsy-58_NeMe-I |
|||
|
Source: Neogobius melanostomus |
Organism: Neogobius melanostomus |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Gobiaria; Gobiiformes; Gobioidei; Gobiidae; Benthophilinae; Neogobiini; Neogobius |
|
| [] |
Authors: Kojima,K.K. |
||
|
Title: LTR retrotransposons from the round goby genome. |
|||
|
Journal: Repbase Reports 23(5), 3260-3260 (2023) |
|||
Abstract: ~99% identical to consensus. It includes an array of repeats of "gggggtgcagccgtcgccagcgccgcagagagaaccgccgtc" between the retropepsin and reverse transcriptase domains.
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||